Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
Hsa_Circ_0091579 | |||
Gene | Organism | Human | |
Genome Locus | Build | hg19 | |
Disease | Hepatocellular Carcinoma | ICD-10 | Liver cell carcinoma (C22.0) |
DBLink | PMID | 30453307 | |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | A total of 105 HCC and paired adjacent non-cancerous tissue samples |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TGAGCCAGTGGTCAGTCAAA ReverseGTGGAGTCAGGCTTGGGTAG | Statistics | Fold Change : Upregulated pvalue : <0.05 |
Citation | |||
Zhang, C, Zhang, C, Lin, J, Wang, H (2018). Circular RNA Hsa_Circ_0091579 Serves as a Diagnostic and Prognostic Marker for Hepatocellular Carcinoma. Cell. Physiol. Biochem., 51, 1:290-300. |